miRNA miRCarta

m-383 in Equus caballus

Accession m-383
Sequence (5' -> 3') (22 nts)  AAUCGUACAGGGUCAUCCACUU
Sequence (5' -> 3') with flanks GAAUCGUACAGGGUCAUCCACUUUUU
similar to miRNAs from miRBase bta-miR-487b (MIMAT0003847)
cfa-miR-487b (MIMAT0006723)
chi-miR-487b-3p (MIMAT0036249)
eca-miR-487b (MIMAT0013162)
ggo-miR-487b (MIMAT0024105)
hsa-miR-487b-3p (MIMAT0003180)
mml-miR-487b-3p (MIMAT0006347)
mmu-miR-487b-3p (MIMAT0003184)
oar-miR-487b-3p (MIMAT0019295)
ppy-miR-487b (MIMAT0015906)
ptr-miR-487b (MIMAT0008162)
rno-miR-487b-3p (MIMAT0003200)
Located in precursor eca-383.1
24:42,916,570-42,916,591 (+)
MFE -1.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree