miRNA miRCarta

m-36911 in Ophiophagus hannah

Accession m-36911
Sequence (5' -> 3') (21 nts)  UCAACAAUAUCCUGGUGCUGA
Sequence (5' -> 3') with flanks GUCAACAAUAUCCUGGUGCUGAGUG
similar to miRNAs from miRBase oha-miR-338-5p (MIMAT0036903)
Located in precursor oha-36911-118.1
AZIM01000013.1:479,386-479,406 (-)
MFE 0.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree