miRNA miRCarta

m-35844

Accession m-35844
Sequence (5' -> 3') (23 nts)  AGCUGGUGUUGUGAAUCAGGCCG
Sequence (5' -> 3') with flanks CAGCUGGUGUUGUGAAUCAGGCCGUCA
similar to miRNAs from miRBase oha-miR-138-5p (MIMAT0036710)
tgu-miR-138-5p (MIMAT0014515)
Organisms Ophiophagus hannah
Taeniopygia guttata
Located in precursor oha-35844-37089.1
AZIM01005485.1:8,207-8,229 (-)
Located in precursor tgu-35844-35843.1
chr2:61,108,007-61,108,029 (-)
MFE -4.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree