miRNA miRCarta

m-322

Accession m-322
Sequence (5' -> 3') (22 nts)  CAUCAUCGUCUCAAAUGAGUCU
Sequence (5' -> 3') with flanks CCAUCAUCGUCUCAAAUGAGUCUUCA
similar to miRNAs from miRBase hsa-miR-136-3p (MIMAT0004606)
rno-miR-136-3p (MIMAT0004733)
Organisms Homo sapiens
Rattus norvegicus
Located in precursor hsa-269-322.1
14:100,884,750-100,884,771 (+)
Located in precursor rno-269-322.1
chr6:133,716,809-133,716,830 (+)
MFE -1.10 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree