| Accession | m-300 |
| Sequence (5' -> 3') (22 nts) | AACUGGCCUACAAAGUCCCAGU |
| Sequence (5' -> 3') with flanks | CAACUGGCCUACAAAGUCCCAGUUCU |
| similar to miRNAs from miRBase |
gga-miR-193a-3p (MIMAT0007740) ggo-miR-193a (MIMAT0024174) hsa-miR-193a-3p (MIMAT0000459) mdo-miR-193a-3p (MIMAT0004123) oha-miR-193-3p (MIMAT0036780) ptr-miR-193a (MIMAT0008058) |
| Organisms |
Gallus gallus Gorilla gorilla Homo sapiens Monodelphis domestica Ophiophagus hannah Pan troglodytes |
| Located in precursor |
gga-26758-300.1 chr18:6,491,374-6,491,395 (+) |
| Located in precursor |
ggo-300.1 5:51,826,146-51,826,167 (-) |
| Located in precursor |
hsa-123-300.1 17:31,560,050-31,560,071 (+) |
| Located in precursor |
mdo-28183-300.1 2:504,311,650-504,311,671 (-) |
| Located in precursor |
oha-36979-300.1 AZIM01000911.1:122,164-122,185 (-) |
| Located in precursor |
ptr-300.1 chr17:25,947,450-25,947,471 (-) |
| MFE | -4.20 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Links | miRNA pathway dictionary (miRPathDB) |