miRNA miRCarta

m-28946 in Macaca mulatta

Accession m-28946
Sequence (5' -> 3') (21 nts)  CCAUCGACCGUUGAGUGGACC
Sequence (5' -> 3') with flanks ACCAUCGACCGUUGAGUGGACCCUG
similar to miRNAs from miRBase mml-miR-181c-3p (MIMAT0026587)
Located in precursor mml-165-28946.1
Chromosome19:13,878,597-13,878,617 (+)
MFE -3.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree