miRNA miRCarta

m-28337

Accession m-28337
Sequence (5' -> 3') (22 nts)  CAGUGCAAUGUAAAAAGGGCAU
Sequence (5' -> 3') with flanks GCAGUGCAAUGUAAAAAGGGCAUUGG
similar to miRNAs from miRBase mdo-miR-130a-3p (MIMAT0004106)
oha-miR-130c-3p (MIMAT0036692)
sha-miR-130a (MIMAT0022830)
Organisms Monodelphis domestica
Ophiophagus hannah
Sarcophilus harrisii
Located in precursor mdo-622-28337.1
5:291,845,649-291,845,670 (+)
Located in precursor oha-36980-28337.1
AZIM01000945.1:91,175-91,196 (-)
Located in precursor sha-28337.1
NW_003846910.1:1,865,438-1,865,459 (+)
MFE -1.40 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms