miRNA miRCarta

m-27454 in Bos taurus

Accession m-27454
Sequence (5' -> 3') (19 nts)  CAAGCUCGCUUCUAUGGGU
Sequence (5' -> 3') with flanks ACAAGCUCGCUUCUAUGGGUCUG
similar to miRNAs from miRBase bta-miR-99a-3p (MIMAT0012533)
cgr-miR-99a-3p (MIMAT0024017)
Located in precursor bta-64-27454.1
Chr1:19,931,198-19,931,216 (-)
MFE -2.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree