| Accession | m-26824 |
| Sequence (5' -> 3') (22 nts) | UAACACUGUCUGGUAACGAUGU |
| Sequence (5' -> 3') with flanks | CUAACACUGUCUGGUAACGAUGUUUA |
| similar to miRNAs from miRBase |
gga-miR-200a-3p (MIMAT0001171) mdo-miR-200a-3p (MIMAT0004158) oha-miR-200a (MIMAT0036807) sha-miR-200a (MIMAT0022805) tgu-miR-200a-3p (MIMAT0014545) xtr-miR-200a (MIMAT0003693) |
| Organisms |
Gallus gallus Monodelphis domestica Ophiophagus hannah Sarcophilus harrisii Taeniopygia guttata Xenopus tropicalis |
| Located in precursor |
gga-26825-26824.1 chr21:2,591,951-2,591,972 (-) |
| Located in precursor |
mdo-26825-26824.1 4:389,169,661-389,169,682 (+) |
| Located in precursor |
oha-26824.1 AZIM01000256.1:133,940-133,961 (+) |
| Located in precursor |
sha-26824.1 NW_003831773.1:162,493-162,514 (+) |
| Located in precursor |
tgu-26825-26824.1 chr21:5,894,368-5,894,389 (+) |
| Located in precursor |
xtr-26824.1 Chr07:78,800,616-78,800,637 (-) |
| MFE | -0.60 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Links | miRNA pathway dictionary (miRPathDB) |