miRNA miRCarta

m-26430 in Gallus gallus

Accession m-26430
Sequence (5' -> 3') (23 nts)  AGCUUCUUUACAGUGCUGCCUUG
Sequence (5' -> 3') with flanks CAGCUUCUUUACAGUGCUGCCUUGUUG
similar to miRNAs from miRBase aca-miR-103-5p (MIMAT0021715)
gga-miR-103-2-5p (MIMAT0026519)
mdo-miR-103-2-5p (MIMAT0031097)
oha-miR-103b-5p (MIMAT0036658)
tgu-miR-103-5p (MIMAT0026985)
Located in precursor gga-26430-12.1
chr4:89,095,115-89,095,137 (-)
MFE -1.20 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree