miRNA miRCarta

m-26214

Accession m-26214
Sequence (5' -> 3') (21 nts)  UUCAAGUAAUCCAGGAUAGGC
Sequence (5' -> 3') with flanks GUUCAAGUAAUCCAGGAUAGGCUGU
similar to miRNAs from miRBase gga-miR-26a-5p (MIMAT0001118)
oha-miR-26-5p (MIMAT0036861)
ola-miR-26 (MIMAT0022575)
tgu-miR-26-5p (MIMAT0014516)
xtr-miR-26 (MIMAT0003569)
Organisms Gallus gallus
Ophiophagus hannah
Oryzias latipes
Taeniopygia guttata
Xenopus tropicalis
Located in precursor gga-26214-26213.1
chr2:4,575,303-4,575,323 (+)
Located in precursor oha-26214-36961.1
AZIM01000386.1:244,728-244,748 (+)
Located in precursor oha-26214-36969.1
AZIM01000576.1:36,346-36,366 (-)
Located in precursor ola-26214.1
17:17,785,605-17,785,625 (-)
Located in precursor tgu-26214-26213.1
chr2:4,696,545-4,696,565 (+)
Located in precursor xtr-26214.1
Chr02:138,750,944-138,750,964 (-)
MFE 0.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree