miRNA miRCarta

m-26000

Accession m-26000
Sequence (5' -> 3') (22 nts)  UCCCUGAGACCCUUAACCUGUG
Sequence (5' -> 3') with flanks GUCCCUGAGACCCUUAACCUGUGAGG
similar to miRNAs from miRBase dre-miR-125a (MIMAT0001820)
oha-miR-125a-5p (MIMAT0036672)
ssa-miR-125b-5p (MIMAT0032307)
xtr-miR-125a (MIMAT0003684)
Organisms Danio rerio
Ophiophagus hannah
Salmo salar
Xenopus tropicalis
Located in precursor dre-26000.1
16:24,898,184-24,898,205 (+)
Located in precursor oha-26000-37055.1
AZIM01003436.1:52,738-52,759 (-)
Located in precursor ssa-26000-31738.1
ssa05:67,131,403-67,131,424 (+)
Located in precursor xtr-26000.1
Chr07:112,726,416-112,726,437 (+)
MFE 0.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree