miRNA miRCarta

m-25101 in Taeniopygia guttata

Accession m-25101
Sequence (5' -> 3') (22 nts)  UAGCUUAUCAGACUGAUGUUGA
Sequence (5' -> 3') with flanks AUAGCUUAUCAGACUGAUGUUGACUG
similar to miRNAs from miRBase gga-miR-21-5p (MIMAT0003774)
mdo-miR-21-5p (MIMAT0004091)
mmu-miR-21a-5p (MIMAT0000530)
oha-miR-21-5p (MIMAT0036824)
sha-miR-21 (MIMAT0022813)
tgu-miR-21-5p (MIMAT0014527)
Located in precursor tgu-25101-35934.1
chr19:8,993,805-8,993,826 (+)
MFE -0.80 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree