miRNA miRCarta

m-25101

Accession m-25101
Sequence (5' -> 3') (22 nts)  UAGCUUAUCAGACUGAUGUUGA
Sequence (5' -> 3') with flanks AUAGCUUAUCAGACUGAUGUUGACUG
similar to miRNAs from miRBase gga-miR-21-5p (MIMAT0003774)
mdo-miR-21-5p (MIMAT0004091)
mmu-miR-21a-5p (MIMAT0000530)
oha-miR-21-5p (MIMAT0036824)
sha-miR-21 (MIMAT0022813)
tgu-miR-21-5p (MIMAT0014527)
Organisms Gallus gallus
Monodelphis domestica
Mus musculus
Ophiophagus hannah
Sarcophilus harrisii
Taeniopygia guttata
Located in precursor gga-25101-26786.1
chr19:7,376,264-7,376,285 (+)
Located in precursor mdo-25101-28146.1
2:172,169,965-172,169,986 (-)
Located in precursor mmu-25101-25100.1
11:86,584,120-86,584,141 (-)
Located in precursor oha-25101-35934.1
AZIM01005944.1:49,877-49,898 (+)
Located in precursor sha-25101.1
NW_003838822.1:2,094,258-2,094,279 (-)
Located in precursor tgu-25101-35934.1
chr19:8,993,805-8,993,826 (+)
MFE -0.80 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree