miRNA miRCarta

m-24456

Accession m-24456
Sequence (5' -> 3') (22 nts)  UGAGAUCCAACUGUAAGGCAUU
Sequence (5' -> 3') with flanks AUGAGAUCCAACUGUAAGGCAUUUCC
similar to miRNAs from miRBase mmu-miR-3471 (MIMAT0015642)
Organisms Mus musculus
Located in precursor mmu-24456.1
4:10,845,585-10,845,606 (-)
MFE -0.10 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree