miRNA miRCarta

m-24413 in Mus musculus

Accession m-24413
Sequence (5' -> 3') (22 nts)  ACCAAUAUUAUUGUGCUGCUUU
Sequence (5' -> 3') with flanks CACCAAUAUUAUUGUGCUGCUUUAGU
similar to miRNAs from miRBase mmu-miR-16-2-3p (MIMAT0017018)
rno-miR-16-3p (MIMAT0017094)
Located in precursor mmu-61-24413.1
3:69,009,960-69,009,981 (+)
MFE 0.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree