miRNA miRCarta

m-23556

Accession m-23556
Sequence (5' -> 3') (22 nts)  UCCUGCAAUCACCAGUCUUCAU
Sequence (5' -> 3') with flanks GUCCUGCAAUCACCAGUCUUCAUUCA
Organisms Homo sapiens
Located in precursor hsa-10036-23556.1
1:67,429,272-67,429,293 (+)
MFE 0.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree