miRNA miRCarta

m-235

Accession m-235
Sequence (5' -> 3') (21 nts)  UGAGCGCCUCGACGACAGAGC
Sequence (5' -> 3') with flanks GUGAGCGCCUCGACGACAGAGCCGG
similar to miRNAs from miRBase ggo-miR-339 (MIMAT0024161)
hsa-miR-339-3p (MIMAT0004702)
mml-miR-339-3p (MIMAT0006280)
Organisms Gorilla gorilla
Homo sapiens
Macaca mulatta
Located in precursor ggo-235.1
7:952,797-952,817 (-)
Located in precursor hsa-163-235.1
7:1,022,957-1,022,977 (-)
Located in precursor mml-163-235.1
Chromosome3:34,941,457-34,941,477 (-)
MFE -1.50 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree