miRNA miRCarta

m-22493

Accession m-22493
Sequence (5' -> 3') (21 nts)  UUUCAGCUACAGGGCAAAUGC
Sequence (5' -> 3') with flanks GUUUCAGCUACAGGGCAAAUGCCAU
Organisms Homo sapiens
Located in precursor hsa-13748-22493.1
8:57,874,915-57,874,935 (-)
MFE -2.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree