miRNA miRCarta

m-2030 in Homo sapiens

Accession m-2030
Sequence (5' -> 3') (21 nts)  GUAAGUGCGCCUCGGGUGAGC
Sequence (5' -> 3') with flanks GGUAAGUGCGCCUCGGGUGAGCAUG
similar to miRNAs from miRBase hsa-miR-668-5p (MIMAT0026636)
Located in precursor hsa-2030-964.1
14:101,055,259-101,055,279 (+)
MFE -3.50 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree