miRNA miRCarta

m-17569 in Homo sapiens

Accession m-17569
Sequence (5' -> 3') (25 nts)  UCUCAGGUCCAAGGGGAGGAACAGG
Sequence (5' -> 3') with flanks GUCUCAGGUCCAAGGGGAGGAACAGGGCG
Located in precursor hsa-17569-17421.1
20:38,569,930-38,569,954 (-)
MFE -1.80 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree