miRNA miRCarta

m-165 in Capra hircus

Accession m-165
Sequence (5' -> 3') (22 nts)  AACAUUCAACCUGUCGGUGAGU
Sequence (5' -> 3') with flanks GAACAUUCAACCUGUCGGUGAGUUUG
similar to miRNAs from miRBase bta-miR-181c (MIMAT0003817)
cfa-miR-181c (MIMAT0006635)
cgr-miR-181c-5p (MIMAT0023801)
chi-miR-181c-5p (MIMAT0036003)
efu-miR-181c (MIMAT0035132)
ggo-miR-181c (MIMAT0002511)
hsa-miR-181c-5p (MIMAT0000258)
mml-miR-181c-5p (MIMAT0002509)
mmu-miR-181c-5p (MIMAT0000674)
ppa-miR-181c (MIMAT0002512)
ppy-miR-181c (MIMAT0015778)
ptr-miR-181c (MIMAT0002510)
rno-miR-181c-5p (MIMAT0000857)
ssc-miR-181c (MIMAT0002144)
tch-miR-181c-5p (MIMAT0036526)
Located in precursor chi-165-24845.1
cluster_8:97,199,092-97,199,113 (-)
MFE -3.80 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree