miRNA miRCarta

m-128 in Sus scrofa

Accession m-128
Sequence (5' -> 3') (23 nts)  UCUCACACAGAAAUCGCACCCGU
Sequence (5' -> 3') with flanks GUCUCACACAGAAAUCGCACCCGUCAC
similar to miRNAs from miRBase cfa-miR-342 (MIMAT0006709)
cgr-miR-342-3p (MIMAT0023923)
eca-miR-342-3p (MIMAT0013137)
efu-miR-342 (MIMAT0034966)
ggo-miR-342 (MIMAT0024101)
hsa-miR-342-3p (MIMAT0000753)
mml-miR-342-3p (MIMAT0006283)
mmu-miR-342-3p (MIMAT0000590)
ppy-miR-342-3p (MIMAT0015845)
ptr-miR-342 (MIMAT0008110)
rno-miR-342-3p (MIMAT0000589)
ssc-miR-342 (MIMAT0013944)
tch-miR-342-3p (MIMAT0036487)
Located in precursor ssc-128.1
Chr7:121,021,808-121,021,830 (+)
MFE 0.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree