| Accession | m-125 |
| Sequence (5' -> 3') (22 nts) | ACCAUCGACCGUUGAUUGUACC |
| Sequence (5' -> 3') with flanks | AACCAUCGACCGUUGAUUGUACCCUA |
| similar to miRNAs from miRBase |
cgr-miR-181a-3p (MIMAT0023798) ggo-miR-181a-3p (MIMAT0002629) hsa-miR-181a-3p (MIMAT0000270) mml-miR-181a-3p (MIMAT0002622) mmu-miR-181a-1-3p (MIMAT0000660) mne-miR-181a-3p (MIMAT0002634) ppa-miR-181a-3p (MIMAT0002636) ppy-miR-181a-3p (MIMAT0002627) ptr-miR-181a-3p (MIMAT0002624) rno-miR-181a-1-3p (MIMAT0000884) sha-miR-181a-3p (MIMAT0022840) |
| Organisms |
Cricetulus griseus Gorilla gorilla Homo sapiens Macaca mulatta Macaca nemestrina Mus musculus Pan paniscus Pan troglodytes Pongo abelii Rattus norvegicus Sarcophilus harrisii |
| Located in precursor |
cgr-32-125.1 NW_003614128.1:850,566-850,587 (+) |
| Located in precursor |
ggo-32-125.1 1:178,419,896-178,419,917 (+) |
| Located in precursor |
ggo-32-125.2 1:178,443,855-178,443,876 (-) |
| Located in precursor |
hsa-32-125.1 1:198,859,069-198,859,090 (-) |
| Located in precursor |
mml-32-125.1 Chromosome1:167,910,330-167,910,351 (+) |
| Located in precursor |
mmu-32-125.1 1:137,966,508-137,966,529 (+) |
| Located in precursor |
mne-32-125.1 NW_012010800.1:28,960,565-28,960,586 (-) |
| Located in precursor |
ppa-32-125.1 chr1:178,775,724-178,775,745 (-) |
| Located in precursor |
ppy-32-125.1 1:51,520,637-51,520,658 (+) |
| Located in precursor |
ptr-32-125.1 chr1:177,685,383-177,685,404 (-) |
| Located in precursor |
rno-32-125.1 chr13:54,952,796-54,952,817 (+) |
| Located in precursor |
sha-40106-125.1 NW_003838782.1:2,114,861-2,114,882 (-) |
| MFE | -1.50 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Links | miRNA pathway dictionary (miRPathDB) |