miRNA miRCarta

m-1193

Accession m-1193
Sequence (5' -> 3') (20 nts)  AGUGCCUGCUAUGUGCCAGG
Sequence (5' -> 3') with flanks GAGUGCCUGCUAUGUGCCAGGCAU
similar to miRNAs from miRBase chi-miR-1271-3p (MIMAT0035932)
hsa-miR-1271-3p (MIMAT0022712)
Organisms Capra hircus
Homo sapiens
Located in precursor chi-27603-1193.1
cluster_8:72,765,901-72,765,920 (-)
Located in precursor hsa-380-1193.1
5:176,367,996-176,368,015 (+)
MFE -3.70 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree