miRNA miRCarta

m-118 in Gorilla gorilla

Accession m-118
Sequence (5' -> 3') (22 nts)  UCCAGCAUCAGUGAUUUUGUUG
Sequence (5' -> 3') with flanks CUCCAGCAUCAGUGAUUUUGUUGAAG
similar to miRNAs from miRBase aca-miR-338-3p (MIMAT0021938)
bta-miR-338 (MIMAT0009292)
cfa-miR-338 (MIMAT0006739)
cgr-miR-338 (MIMAT0023918)
chi-miR-338-3p (MIMAT0036150)
eca-miR-338-3p (MIMAT0013036)
ggo-miR-338 (MIMAT0024125)
hsa-miR-338-3p (MIMAT0000763)
mdo-miR-338 (MIMAT0004136)
mml-miR-338-3p (MIMAT0006278)
mmu-miR-338-3p (MIMAT0000582)
oha-miR-338-3p (MIMAT0036904)
ppy-miR-338-3p (MIMAT0015841)
ptr-miR-338 (MIMAT0008106)
rno-miR-338-3p (MIMAT0000581)
sha-miR-338 (MIMAT0022818)
ssc-miR-338 (MIMAT0015713)
Located in precursor ggo-118.1
5:1,923,746-1,923,767 (+)
MFE -2.30 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree