miRNA miRCarta

m-1093 in Homo sapiens

Accession m-1093
Sequence (5' -> 3') (22 nts)  AGUUGCCUUUUUGUUCCCAUGC
Sequence (5' -> 3') with flanks CAGUUGCCUUUUUGUUCCCAUGCUGU
similar to miRNAs from miRBase hsa-miR-4423-5p (MIMAT0019232)
Located in precursor hsa-1093-1341.1
1:85,133,806-85,133,827 (+)
MFE 0.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree