miRNA miRCarta

m-1071

Accession m-1071
Sequence (5' -> 3') (25 nts)  AAAGGAUUCUGCUGUCGGUCCCACU
Sequence (5' -> 3') with flanks GAAAGGAUUCUGCUGUCGGUCCCACUCCA
similar to miRNAs from miRBase hsa-miR-541-5p (MIMAT0004919)
mml-miR-541-5p (MIMAT0012784)
oar-miR-541-5p (MIMAT0019323)
Organisms Homo sapiens
Macaca mulatta
Ovis aries
Located in precursor hsa-1071-808.1
14:101,064,504-101,064,528 (+)
Located in precursor mml-1071-28807.1
Chromosome7:163,398,297-163,398,321 (+)
Located in precursor oar-1071-27901.1
Chromosome18:64,561,277-64,561,301 (+)
MFE -3.20 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree