miRNA miRCarta

m-1 in Gorilla gorilla

Accession m-1
Sequence (5' -> 3') (22 nts)  UAGCUUAUCAGACUGAUGUUGA
Sequence (5' -> 3') with flanks GUAGCUUAUCAGACUGAUGUUGACUG
similar to miRNAs from miRBase bta-miR-21-5p (MIMAT0003528)
cfa-miR-21 (MIMAT0006741)
cgr-miR-21-5p (MIMAT0004417)
chi-miR-21-5p (MIMAT0036061)
eca-miR-21 (MIMAT0013029)
ggo-miR-21 (MIMAT0002322)
hsa-miR-21-5p (MIMAT0000076)
mml-miR-21-5p (MIMAT0002320)
mne-miR-21 (MIMAT0002324)
oar-miR-21 (MIMAT0014966)
ppa-miR-21 (MIMAT0002326)
ptr-miR-21 (MIMAT0002321)
rno-miR-21-5p (MIMAT0000790)
ssc-miR-21 (MIMAT0002165)
tch-miR-21-5p (MIMAT0036592)
Located in precursor ggo-1.1
5:23,505,280-23,505,301 (-)
MFE -0.80 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree