| Accession | MIMAT0000065 | ||||||||
| Name | hsa-let-7d-5p | ||||||||
| similar to following miRCarta miRNAs |
m-90 |
||||||||
| potential naming conflicts with | hsa-let-7d (MI0000065) | ||||||||
| Organism | Homo sapiens | ||||||||
| Genome | GRCh38.p10 | ||||||||
| Sequence (5' -> 3') (22 nts) |
AGAGGUAGUAGGUUGCAUAGUU | ||||||||
| Located in precursor | hsa-let-7d (MI0000065) chr9:94,178,841-94,178,862 (+) |
||||||||
| MFE | 0.00 kcal/mol | ||||||||
| first miRBase version | 1.1 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Experiments |
|
| experimental | ||
| miRTarBase v6.1 | 354 | |
| predicted | ||
| microT-CDS v5.0 (score ≥ 0.7) | 656 | |
| TargetScan v7.1 | 1170 |
| Links |
miRNA pathway dictionary (miRPathDB)
miRTargetLink Human Tissue Atlas miR2Disease |
| Experimentally supported targets |
TarBase
miRTarBase |
| Predicted targets | MicroT-CDS |