miRNA miRBase

cfa-let-7b (MIMAT0009836)

Accession MIMAT0009836
Name cfa-let-7b
similar to following miRCarta miRNAs m-14
potential naming conflicts with cfa-let-7b (MI0010329)
Organism Canis familiaris
Genome CanFam3.1
Sequence (5' -> 3')
(22 nts)
UGAGGUAGUAGGUUGUGUGGUU
Located in precursor cfa-let-7b (MI0010329)
chr10:20,033,446-20,033,467 (-)
MFE 0.00 kcal/mol
first miRBase version 13.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree