miRNA miRBase

gga-miR-301b-3p (MIMAT0007742)

Accession MIMAT0007742
Name gga-miR-301b-3p
similar to following miRCarta miRNAs m-277
Organism Gallus gallus
Genome Gallus-gallus-4.0
Sequence (5' -> 3')
(25 nts)
CAGUGCAAUAGUAUUGUCAAAGCAU
Located in precursor gga-mir-301b (MI0007565)
chr19:7,193,236-7,193,260 (-)
MFE -4.10 kcal/mol
first miRBase version 12.0
last miRBase version 21.0
Experiments
experiment Pubmed link
Illumina 18469162
Northern blot 18511220

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree