| Accession | MIMAT0004800 | ||||
| Name | hsa-miR-550a-5p | ||||
| similar to following miRCarta miRNAs |
m-340 |
||||
| potential naming conflicts with | hsa-miR-550a-3p (MIMAT0003257) | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Sequence (5' -> 3') (23 nts) |
AGUGCCUGAGGGAGUAAGAGCCC | ||||
| Located in precursor | hsa-mir-550a-1 (MI0003600) chr7:30,289,815-30,289,837 (+) |
||||
| Located in precursor | hsa-mir-550a-2 (MI0003601) chr7:32,733,002-32,733,024 (+) |
||||
| MFE | -2.60 kcal/mol | ||||
| first miRBase version | 10.0 | ||||
| last miRBase version | 21.0 | ||||
| Experiments |
|
| experimental | ||
| miRTarBase v6.1 | 86 | |
| predicted | ||
| microT-CDS v5.0 (score ≥ 0.7) | 389 | |
| TargetScan v7.1 | 0 |
| Links |
miRNA pathway dictionary (miRPathDB)
miRTargetLink Human Tissue Atlas miR2Disease |
| Experimentally supported targets |
TarBase
miRTarBase |
| Predicted targets | MicroT-CDS |