miRNA miRBase

oha-miR-20a-5p (MIMAT0036822)

Accession MIMAT0036822
Name oha-miR-20a-5p
similar to following miRCarta miRNAs m-96
Organism Ophiophagus hannah
Genome OphHan1.0
Sequence (5' -> 3')
(23 nts)
UAAAGUGCUUAUAGUGCAGGUAG
Located in precursor oha-mir-20a (MI0031410)
AZIM01002132.1:158,015-158,037 (-)
MFE -2.40 kcal/mol
first miRBase version 21.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree