miRNA miRBase

oha-miR-10c-5p (MIMAT0036664)

Accession MIMAT0036664
Name oha-miR-10c-5p
similar to following miRCarta miRNAs m-8
Organism Ophiophagus hannah
Genome OphHan1.0
Sequence (5' -> 3')
(25 nts)
UACCCUGUAGAACCGAAUUUGUGUG
Located in precursor oha-mir-10c (MI0031321)
AZIM01000055.1:585,904-585,928 (+)
MFE 0.00 kcal/mol
first miRBase version 21.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree