miRNA miRBase

efu-let-7f (MIMAT0035017)

Accession MIMAT0035017
Name efu-let-7f
similar to following miRCarta miRNAs m-20
potential naming conflicts with efu-let-7f (MI0028702)
Organism Eptesicus fuscus
Genome EptFus1.0
Sequence (5' -> 3')
(25 nts)
UGAGGUAGUAGAUUGUAUAGUUGUG
Located in precursor efu-let-7f (MI0028702)
JH977714.1:1,024,372-1,024,396 (+)
MFE 0.00 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Experiments
experiment Pubmed link
Illumina 24692655

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree