miRNA miRBase

ppy-miR-181b (MIMAT0002628)

Accession MIMAT0002628
Name ppy-miR-181b
similar to following miRCarta miRNAs m-72
m-73
Organism Pongo abelii
Genome PPYG2
Sequence (5' -> 3')
(23 nts)
AACAUUCAUUGCUGUCGGUGGGU
Located in precursor ppy-mir-181b-2 (MI0014845)
9:121,589,389-121,589,411 (+)
Located in precursor ppy-mir-181b (MI0002936)
1:51,520,780-51,520,802 (+)
MFE -3.50 kcal/mol
first miRBase version 7.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree