miRNA miRBase

ppy-miR-29b (MIMAT0002434)

Accession MIMAT0002434
Name ppy-miR-29b
similar to following miRCarta miRNAs m-81
m-82
Organism Pongo abelii
Genome PPYG2
Sequence (5' -> 3')
(20 nts)
UAGCACCAUUUGAAAUCAGU
Located in precursor ppy-mir-29b-1 (MI0002726)
7:127,859,577-127,859,596 (-)
Located in precursor ppy-mir-29b-2 (MI0002734)
1:42,327,595-42,327,614 (+)
MFE 0.00 kcal/mol
first miRBase version 7.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree