miRNA miRBase

ggo-miR-21 (MIMAT0002322)

Accession MIMAT0002322
Name ggo-miR-21
similar to following miRCarta miRNAs m-1
Organism Gorilla gorilla
Genome GorGor3
Sequence (5' -> 3')
(22 nts)
UAGCUUAUCAGACUGAUGUUGA
Located in precursor ggo-mir-21 (MI0002623)
5:24,023,621-24,023,642 (-)
MFE -0.80 kcal/mol
first miRBase version 7.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree