miRNA miRBase

ppy-miR-539 (MIMAT0015989)

Accession MIMAT0015989
Name ppy-miR-539
similar to following miRCarta miRNAs m-433
Organism Pongo abelii
Genome PPYG2
Sequence (5' -> 3')
(22 nts)
GGAGAAAUUAUCCUUGGUGUGU
Located in precursor ppy-mir-539 (MI0015038)
14:102,609,461-102,609,482 (+)
MFE -2.10 kcal/mol
first miRBase version 15.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree