miRNA miRBase

ppy-miR-376b (MIMAT0015865)

Accession MIMAT0015865
Name ppy-miR-376b
similar to following miRCarta miRNAs m-636
Organism Pongo abelii
Genome PPYG2
Sequence (5' -> 3')
(22 nts)
AUCAUAGAGGAAAAUCCAUGUU
Located in precursor ppy-mir-376b (MI0014923)
14:102,602,630-102,602,651 (+)
MFE -1.30 kcal/mol
first miRBase version 15.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree