miRNA miRBase

ppy-miR-10b (MIMAT0015730)

Accession MIMAT0015730
Name ppy-miR-10b
similar to following miRCarta miRNAs m-8
Organism Pongo abelii
Genome PPYG2
Sequence (5' -> 3')
(23 nts)
UACCCUGUAGAACCGAAUUUGUG
Located in precursor ppy-mir-10b (MI0014794)
2b:66,307,734-66,307,756 (+)
MFE 0.00 kcal/mol
first miRBase version 15.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree