miRNA miRBase

eca-let-7f (MIMAT0013111)

Accession MIMAT0013111
Name eca-let-7f
similar to following miRCarta miRNAs m-20
potential naming conflicts with eca-let-7f (MI0012860)
Organism Equus caballus
Genome Equ Cab 2
Sequence (5' -> 3')
(22 nts)
UGAGGUAGUAGAUUGUAUAGUU
Located in precursor eca-let-7f (MI0012860)
chr23:54,150,817-54,150,838 (-)
MFE 0.00 kcal/mol
first miRBase version 14.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree