miRNA miRBase

gga-miR-29c-3p (MIMAT0001183)

Accession MIMAT0001183
Name gga-miR-29c-3p
similar to following miRCarta miRNAs m-51
Organism Gallus gallus
Genome Gallus-gallus-4.0
Sequence (5' -> 3')
(20 nts)
UAGCACCAUUUGAAAUCGGU
Located in precursor gga-mir-29c (MI0001265)
chr26:2,640,720-2,640,739 (-)
MFE -0.30 kcal/mol
first miRBase version 4.0
last miRBase version 21.0
Experiments
experiment Pubmed link
Illumina 23034410

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree