miRNA miRBase

gga-let-7j-5p (MIMAT0001181)

Accession MIMAT0001181
Name gga-let-7j-5p
similar to following miRCarta miRNAs m-5
potential naming conflicts with gga-let-7j (MI0001262)
Organism Gallus gallus
Genome Gallus-gallus-4.0
Sequence (5' -> 3')
(22 nts)
UGAGGUAGUAGGUUGUAUAGUU
Located in precursor gga-let-7j (MI0001262)
chr26:1,591,978-1,591,999 (-)
MFE 0.00 kcal/mol
first miRBase version 4.0
last miRBase version 21.0
Experiments
experiment Pubmed link
Illumina 23034410

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree