miRNA miRBase

gga-miR-223 (MIMAT0001140)

Accession MIMAT0001140
Name gga-miR-223
similar to following miRCarta miRNAs m-120
Organism Gallus gallus
Genome Gallus-gallus-4.0
Sequence (5' -> 3')
(21 nts)
UGUCAGUUUGUCAAAUACCCC
Located in precursor gga-mir-223 (MI0001208)
chr4:242,727-242,747 (+)
MFE 0.00 kcal/mol
first miRBase version 4.0
last miRBase version 21.0

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree