miRNA miRBase

gga-miR-92-3p (MIMAT0001109)

Accession MIMAT0001109
Name gga-miR-92-3p
similar to following miRCarta miRNAs m-9
Organism Gallus gallus
Genome Gallus-gallus-4.0
Sequence (5' -> 3')
(21 nts)
UAUUGCACUUGUCCCGGCCUG
Located in precursor gga-mir-92-1 (MI0001179)
chr1:147,253,138-147,253,158 (-)
MFE 0.00 kcal/mol
first miRBase version 4.0
last miRBase version 21.0
Experiments
experiment Pubmed link
Illumina 23034410
cloned 18256158

Targets integrated in miRCarta

experimental
miRTarBase v6.1 0
predicted
microT-CDS v5.0 (score ≥ 0.7) 0
TargetScan v7.1 0
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree