Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: sha-miR-21

sha-miR-21 (MIMAT0022813)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
18.0 new record MIMAT0022813 sha-miR-21 UAGCUUAUCAGACUGAUGUUGACUG MI0019641
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree