Tracking Information miRBase

1 result for query: rno-miR-181c-5p

rno-miR-181c-5p (MIMAT0000857)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
3.1 new record MIMAT0000857 rno-miR-181c AACAUUCAACCUGUCGGUGAGU MI0000924
19.0 miRNA name MIMAT0000857 rno-miR-181c-5p AACAUUCAACCUGUCGGUGAGU MI0000924
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree