Tracking Information miRBase

  1. Dashboard
  2. Tracking Information
1 result for query: ptr-miR-376c

ptr-miR-376c (MIMAT0008128)


version changes miRNA accession(s) query name(s) query sequence(s) precursor accession(s)
12.0 new record MIMAT0008128 ptr-miR-376c AACAUAGAGGAAAUUCCACGU MI0008649
Imprint Data protection
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree